Reverse Complement

Overview

The Reverse Complement function in the Sequence Manipulation Tools combines both operations — it replaces each nucleotide with its complementary base and reverses the order of the resulting sequence. This produces the antiparallel complementary strand, which is commonly needed in molecular biology for primer design, cloning, and sequence analysis.

Complement Pairing Rules

 

Original Base	Complement Base
A	T
T	A
G	C
C	G

 

How It Works

1. Navigate to the Reverse Complement tab in the Sequence Manipulation Tools.
2. Enter or paste a DNA sequence into the Enter DNA Sequence text area, or use the Upload from file option.
3. Click the Reverse Complement button.
4. The reverse complemented sequence is displayed in the Output – Reverse Complement section below.

Example

 

Field	Sequence
Input	AGCTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCCTTTCATACTGATGGTACGATTACAATAA
Output	TTATTGTAATCGTACCATCAGTATGAAAGGCTGCTATCAGACACTCTTTTTTTAATCCACACAGAGACATATTGCCCGTTGCAGTCAGAATGAAAAGCT

 

The output is produced by first complementing each base (A↔T, G↔C) and then reversing the entire sequence.

Feature Location

• Tab: Reverse Complement
• Button: Reverse Complement (green button, third in the row of operation buttons)

User Workflow

1. Paste or type a DNA sequence into the input field.
2. Optionally enable Highlight illegal characters to verify the sequence contains only valid nucleotides (A, T, G, C).
3. Click the Reverse Complement button.
4. The result appears in the Output – Reverse Complement section.
5. Click Copy to Clipboard to copy the reverse complemented sequence for further use.

Comparison of Operations

 

Operation	Complements Bases?	Reverses Order?	Result
Reverse	No	Yes	Same bases, reversed order
Complement	Yes	No	Complemented bases, same order
Reverse Complement	Yes	Yes	Complemented bases, reversed order

Common Use Cases

• Primer design – Generating the reverse complement of a template strand for designing reverse primers.
• Cloning & ligation – Determining the complementary strand for restriction enzyme site analysis.
• Sequence annotation – Viewing the antiparallel strand for gene annotation on the opposite strand.

Notes

• Reverse Complement is equivalent to performing the Complement operation followed by the Reverse operation (or vice versa — the order does not matter).
• The output label updates to "Output – Reverse Complement" to indicate which operation was performed.
• Non-nucleotide characters in the input are passed through without complementation.